PIMT is a novel and potent suppressor of endothelial activation.

Proinflammatory agonists provoke the expression of cell surface adhesion molecules on endothelium in order to facilitate leukocyte infiltration into tissues. Rigorous control over this process is important to prevent unwanted inflammation and organ damage. Protein L-isoaspartyl O-methyltransferase (PIMT) converts isoaspartyl residues to conventional methylated forms in cells undergoing stress-induced protein damage. The purpose of this study was to determine the role of PIMT in vascular homeostasis. PIMT is abundantly expressed in mouse lung endothelium and PIMT deficiency in mice exacerbated pulmonary inflammation and vascular leakage to LPS(lipopolysaccharide). Furthermore, we found that PIMT inhibited LPS-induced toll-like receptor signaling through its interaction with TNF receptor-associated factor 6 (TRAF6) and its ability to methylate asparagine residues in the coiled-coil domain. This interaction was found to inhibit TRAF6 oligomerization and autoubiquitination, which prevented NF-κB transactivation and subsequent expression of endothelial adhesion molecules. Separately, PIMT also suppressed ICAM-1 expression by inhibiting its N-glycosylation, causing effects on protein stability that ultimately translated into reduced EC(endothelial cell)-leukocyte interactions. Our study has identified PIMT as a novel and potent suppressor of endothelial activation. Taken together, these findings suggest that therapeutic targeting of PIMT may be effective in limiting organ injury in inflammatory vascular diseases.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Aorta in Pathologies May Function as an Immune Organ by Upregulating Secretomes for Immune and Vascular Cell Activation, Differentiation and Trans-Differentiation-Early Secretomes may Serve as Drivers for Trained Immunity.

To determine whether aorta becomes immune organ in pathologies, we performed transcriptomic analyses of six types of secretomic genes (SGs) in aorta and vascular cells and made the following findings: 1) 53.7% out of 21,306 human protein genes are classified into six secretomes, namely, canonical, caspase 1, caspase 4, exosome, Weibel-Palade body, and autophagy; 2) Atherosclerosis (AS), chronic kidney disease (CKD) and abdominal aortic aneurysm (AAA) modulate six secretomes in aortas; and Middle East Respiratory Syndrome Coronavirus (MERS-CoV, COVID-19 homologous) infected endothelial cells (ECs) and angiotensin-II (Ang-II) treated vascular smooth muscle cells (VSMCs) modulate six secretomes; 3) AS aortas upregulate T and B cell immune SGs; CKD aortas upregulate SGs for cardiac hypertrophy, and hepatic fibrosis; and AAA aorta upregulate SGs for neuromuscular signaling and protein catabolism; 4) Ang-II induced AAA, canonical, caspase 4, and exosome SGs have two expression peaks of high (day 7)-low (day 14)-high (day 28) patterns; 5) Elastase induced AAA aortas have more inflammatory/immune pathways than that of Ang-II induced AAA aortas; 6) Most disease-upregulated cytokines in aorta may be secreted via canonical and exosome secretomes; 7) Canonical and caspase 1 SGs play roles at early MERS-CoV infected ECs whereas caspase 4 and exosome SGs play roles in late/chronic phases; and the early upregulated canonical and caspase 1 SGs may function as drivers for trained immunity (innate immune memory); 8) Venous ECs from arteriovenous fistula (AVF) upregulate SGs in five secretomes; and 9) Increased some of 101 trained immunity genes and decreased trained tolerance regulator IRG1 participate in upregulations of SGs in atherosclerotic, Ang-II induced AAA and CKD aortas, and MERS-CoV infected ECs, but less in SGs upregulated in AVF ECs. IL-1 family cytokines, HIF1α, SET7 and mTOR, ROS regulators NRF2 and NOX2 partially regulate trained immunity genes; and NRF2 plays roles in downregulating SGs more than that of NOX2 in upregulating SGs. These results provide novel insights on the roles of aorta as immune organ in upregulating secretomes and driving immune and vascular cell differentiations in COVID-19, cardiovascular diseases, inflammations, transplantations, autoimmune diseases and cancers.

Review of Machine Learning in Lung Ultrasound in COVID-19 Pandemic.

Ultrasound imaging of the lung has played an important role in managing patients with COVID-19-associated pneumonia and acute respiratory distress syndrome (ARDS). During the COVID-19 pandemic, lung ultrasound (LUS) or point-of-care ultrasound (POCUS) has been a popular diagnostic tool due to its unique imaging capability and logistical advantages over chest X-ray and CT. Pneumonia/ARDS is associated with the sonographic appearances of pleural line irregularities and B-line artefacts, which are caused by interstitial thickening and inflammation, and increase in number with severity. Artificial intelligence (AI), particularly machine learning, is increasingly used as a critical tool that assists clinicians in LUS image reading and COVID-19 decision making. We conducted a systematic review from academic databases (PubMed and Google Scholar) and preprints on arXiv or TechRxiv of the state-of-the-art machine learning technologies for LUS images in COVID-19 diagnosis. Openly accessible LUS datasets are listed. Various machine learning architectures have been employed to evaluate LUS and showed high performance. This paper will summarize the current development of AI for COVID-19 management and the outlook for emerging trends of combining AI-based LUS with robotics, telehealth, and other techniques.

29 m6A-RNA Methylation (Epitranscriptomic) Regulators Are Regulated in 41 Diseases including Atherosclerosis and Tumors Potentially via ROS Regulation - 102 Transcriptomic Dataset Analyses.

We performed a database mining on 102 transcriptomic datasets for the expressions of 29 m6A-RNA methylation (epitranscriptomic) regulators (m6A-RMRs) in 41 diseases and cancers and made significant findings: (1) a few m6A-RMRs were upregulated; and most m6A-RMRs were downregulated in sepsis, acute respiratory distress syndrome, shock, and trauma; (2) half of 29 m6A-RMRs were downregulated in atherosclerosis; (3) inflammatory bowel disease and rheumatoid arthritis modulated m6A-RMRs more than lupus and psoriasis; (4) some organ failures shared eight upregulated m6A-RMRs; end-stage renal failure (ESRF) downregulated 85% of m6A-RMRs; (5) Middle-East respiratory syndrome coronavirus infections modulated m6A-RMRs the most among viral infections; (6) proinflammatory oxPAPC modulated m6A-RMRs more than DAMP stimulation including LPS and oxLDL; (7) upregulated m6A-RMRs were more than downregulated m6A-RMRs in cancer types; five types of cancers upregulated ≥10 m6A-RMRs; (8) proinflammatory M1 macrophages upregulated seven m6A-RMRs; (9) 86% of m6A-RMRs were differentially expressed in the six clusters of CD4+Foxp3+ immunosuppressive Treg, and 8 out of 12 Treg signatures regulated m6A-RMRs; (10) immune checkpoint receptors TIM3, TIGIT, PD-L2, and CTLA4 modulated m6A-RMRs, and inhibition of CD40 upregulated m6A-RMRs; (11) cytokines and interferons modulated m6A-RMRs; (12) NF-κB and JAK/STAT pathways upregulated more than downregulated m6A-RMRs whereas TP53, PTEN, and APC did the opposite; (13) methionine-homocysteine-methyl cycle enzyme Mthfd1 downregulated more than upregulated m6A-RMRs; (14) m6A writer RBM15 and one m6A eraser FTO, H3K4 methyltransferase MLL1, and DNA methyltransferase, DNMT1, regulated m6A-RMRs; and (15) 40 out of 165 ROS regulators were modulated by m6A eraser FTO and two m6A writers METTL3 and WTAP. Our findings shed new light on the functions of upregulated m6A-RMRs in 41 diseases and cancers, nine cellular and molecular mechanisms, novel therapeutic targets for inflammatory disorders, metabolic cardiovascular diseases, autoimmune diseases, organ failures, and cancers.

DExD/H-box helicase 9 intrinsically controls CD8+ T cell-mediated antiviral response through noncanonical mechanisms.

Upon virus infection, CD8+ T cell accumulation is tightly controlled by simultaneous proliferation and apoptosis. However, it remains unclear how TCR signal coordinates these events to achieve expansion and effector cell differentiation. We found that T cell-specific deletion of nuclear helicase Dhx9 led to impaired CD8+ T cell survival, effector differentiation, and viral clearance. Mechanistically, Dhx9 acts as the key regulator to ensure LCK- and CD3ε-mediated ZAP70 phosphorylation and ERK activation to protect CD8+ T cells from apoptosis before proliferative burst. Dhx9 directly regulates Id2 transcription to control effector CD8+ T cell differentiation. The DSRM and OB_Fold domains are required for LCK binding and Id2 transcription, respectively. Dhx9 expression is predominantly increased in effector CD8+ T cells of COVID-19 patients. Therefore, we revealed a previously unknown regulatory mechanism that Dhx9 protects activated CD8+ T cells from apoptosis and ensures effector differentiation to promote antiviral immunity independent of nuclear sensor function.

ORF3a Protein of Severe Acute Respiratory Syndrome Coronavirus 2 Inhibits Interferon-Activated Janus Kinase/Signal Transducer and Activator of Transcription Signaling via Elevating Suppressor of Cytokine Signaling 1.

Coronavirus disease 2019 (COVID-19) has caused a crisis to global public health since its outbreak at the end of 2019. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the pathogen of COVID-19, appears to efficiently evade the host immune responses, including interferon (IFN) signaling. Several SARS-CoV-2 viral proteins are believed to involve in the inhibition of IFN signaling. In this study, we discovered that ORF3a, an accessory protein of SARS-CoV-2, inhibited IFN-activated Janus kinase (JAK)/signal transducer and activator of transcription (STAT) signaling via upregulating suppressor of cytokine signaling 1 (SOCS1), a negative regulator of cytokine signaling. ORF3a induced SOCS1 elevation in a dose- and time-dependent manner. RNAi-mediated silencing of SOCS1 efficiently abolished ORF3a-induced blockage of JAK/STAT signaling. Interestingly, we found that ORF3a also promoted the ubiquitin-proteasomal degradation of Janus kinase 2 (JAK2), an important kinase in IFN signaling. Silencing of SOCS1 by siRNA distinctly blocked ORF3a-induced JAK2 ubiquitination and degradation. These results demonstrate that ORF3a dampens IFN signaling via upregulating SOCS1, which suppressed STAT1 phosphorylation and accelerated JAK2 ubiquitin-proteasomal degradation. Furthermore, analysis of ORF3a deletion constructs showed that the middle domain of ORF3a (amino acids 70-130) was responsible for SOCS1 upregulation. These findings contribute to our understanding of the mechanism of SARS-CoV-2 antagonizing host antiviral response.

Chest CT Features from 58 Patients with COVID-19 Pneumonia from the Perspective of ACE2.

BACKGROUND: Chest CT is important for the diagnosis of Corona Virus Disease 2019, which is caused by SARS-CoV-2 via the receptor angiotensin-converting enzyme 2. This study aimed to present special chest CT changes in the detection and management of COVID-19. METHODS: From February 20 to March 6, 2020, clinical data and chest CT of patients with COVID-19 being treated by the Hubei Medical Team were retrospectively analyzed with a time-interval of 2 weeks. In addition, the expressions of ACE2 in different parts of the respiratory system were detected by immunohistochemical staining to explain the special chest CT features of COVID-19 by ACE2 expression. RESULTS: Of 58 patients, the main respiratory manifestations were fever and cough. Spherical or patchy GGO was the initial CT manifestation of COVID-19 pneumonia. CT findings manifested as rapid evolution from focal unilateral to diffuse bilateral ground-glass opacities (GGO) that progressed to or co-existed with consolidations in chest CT scans. Lung consolidation increased as the disease progressed, accounting for 63.2%, 76.3%, and 87.5% in group 1 (disease course with 0 - 2 weeks), group 2 (2 - 4 weeks), and group 3 (> 4 weeks). Fibrous lesions (72.3%), high density vascular shadow (69.2%), reticular pattern (63.1%), and subpleural parallel sign (61.5%) were common signs of chest CT of COVID-19. IHC results showed that ACE2-expression in the pulmonary alveoli was significantly higher than that in the bronchial mucosa and pleura (p < 0.001). CONCLUSIONS: The special change of CT features in the lung of COVID-19 pneumonia patients have a connection with ACE2 expression patterns in the respiratory system.

Endothelial Immunity Trained by Coronavirus Infections, DAMP Stimulations and Regulated by Anti-Oxidant NRF2 May Contribute to Inflammations, Myelopoiesis, COVID-19 Cytokine Storms and Thromboembolism.

To characterize transcriptomic changes in endothelial cells (ECs) infected by coronaviruses, and stimulated by DAMPs, the expressions of 1311 innate immune regulatomic genes (IGs) were examined in 28 EC microarray datasets with 7 monocyte datasets as controls. We made the following findings: The majority of IGs are upregulated in the first 12 hours post-infection (PI), and maintained until 48 hours PI in human microvascular EC infected by middle east respiratory syndrome-coronavirus (MERS-CoV) (an EC model for COVID-19). The expressions of IGs are modulated in 21 human EC transcriptomic datasets by various PAMPs/DAMPs, including LPS, LPC, shear stress, hyperlipidemia and oxLDL. Upregulation of many IGs such as nucleic acid sensors are shared between ECs infected by MERS-CoV and those stimulated by PAMPs and DAMPs. Human heart EC and mouse aortic EC express all four types of coronavirus receptors such as ANPEP, CEACAM1, ACE2, DPP4 and virus entry facilitator TMPRSS2 (heart EC); most of coronavirus replication-transcription protein complexes are expressed in HMEC, which contribute to viremia, thromboembolism, and cardiovascular comorbidities of COVID-19. ECs have novel trained immunity (TI), in which subsequent inflammation is enhanced. Upregulated proinflammatory cytokines such as TNFα, IL6, CSF1 and CSF3 and TI marker IL-32 as well as TI metabolic enzymes and epigenetic enzymes indicate TI function in HMEC infected by MERS-CoV, which may drive cytokine storms. Upregulated CSF1 and CSF3 demonstrate a novel function of ECs in promoting myelopoiesis. Mechanistically, the ER stress and ROS, together with decreased mitochondrial OXPHOS complexes, facilitate a proinflammatory response and TI. Additionally, an increase of the regulators of mitotic catastrophe cell death, apoptosis, ferroptosis, inflammasomes-driven pyroptosis in ECs infected with MERS-CoV and the upregulation of pro-thrombogenic factors increase thromboembolism potential. Finally, NRF2-suppressed ROS regulate innate immune responses, TI, thrombosis, EC inflammation and death. These transcriptomic results provide novel insights on the roles of ECs in coronavirus infections such as COVID-19, cardiovascular diseases (CVD), inflammation, transplantation, autoimmune disease and cancers.

Spatial Characteristics of Coronavirus Disease 2019 and Their Possible Relationship With Environmental and Meteorological Factors in Hubei Province, China.

As of July 27, 2020, COVID-19 has caused 640,000 deaths worldwide and has had a major impact on people's productivity and lives. Analyzing the spatial distribution characteristics of COVID-19 cases and their relationships with meteorological and environmental factors might help enrich our knowledge of virus transmission and formulate reasonable epidemic prevention strategies. Taking the cumulative confirmed cases in Hubei province from January 23, 2020, to April 8, 2020, as an example, this study analyzed the spatial evolution characteristics of confirmed COVID-19 cases in Hubei province using exploratory spatial data analysis and explored the spatial relationship between the main environmental and meteorological factors and confirmed COVID-19 cases using a geographically weighted regression (GWR) model. Results show that there was no obvious spatial clustering of confirmed COVID-19 cases in Hubei province, while the decline and end of the newly confirmed cases revealed relatively obvious negative spatial correlations. Due to the lockdown in Hubei province, the main air quality indexes (e.g., AQI and PM2.5) decreased significantly and environmental quality was better than historical contemporaneous levels. Meanwhile, the results of the GWR model suggest that the impacts of environmental and meteorological factors on the development of COVID-19 were not significant. These findings indicate that measures such as social distancing and isolation played the primary role in controlling the development of the COVID-19 epidemic.

Naturally activated adaptive immunity in COVID-19 patients.

Coronavirus disease-2019 (COVID-19) caused by severe acute respiratory syndrome coronavirus (SARS-CoV-2) has rapidly spread worldwide, threatening the health and lives of many people. Unfortunately, information regarding the immunological characteristics of COVID-19 patients remains limited. Herein, we collected blood samples from 18 healthy donors (HDs) and 38 COVID-19 patients to analyse changes in the adaptive immune cell populations and their phenotypes. We observed that the lymphocyte percentage moderately decreased, CD4 and CD8 T cell percentage among lymphocytes were similar, and B cell percentage was increased in COVID-19 patients in comparison to that in HDs. T cells, especially CD8 T cells, showed an enhanced expression of late activation marker CD25 and exhaustion marker PD-1. Importantly, SARS-CoV-2 infection increased the percentage of T follicular helper- and germinal centre B-like cells in the blood. The parameters in COVID-19 patients remained unchanged across various age groups. Therefore, we demonstrated that the T and B cells are activated naturally and are functional during SARS-CoV-2 infection. These data provide evidence that the adaptive immunity in most patients could be primed to induce a significant immune response against SARS-CoV-2 infection upon receiving standard medical care.

Ultrasound Elastography for Lung Disease Assessment.

Ultrasound elastography (US-E) is a noninvasive, safe, cost-effective and reliable technique to assess the mechanical properties of soft tissue and provide imaging biomarkers for pathological processes. Many lung diseases such as acute respiratory distress syndrome, chronic obstructive pulmonary disease, and interstitial lung disease are associated with dramatic changes in mechanical properties of lung tissues. Nevertheless, US-E is rarely used to image the lung because it is filled with air. The large difference in acoustic impedance between air and lung tissue results in the reflection of the ultrasound wave at the lung surface and, consequently, the loss of most ultrasound energy. In recent years, there has been an increasing interest in US-E applications in evaluating lung diseases. This article provides a comprehensive review of the technological advances of US-E research on lung disease diagnosis. We introduce the basic principles and major techniques of US-E and provide information on various applications in lung disease assessment. Finally, the potential applications of US-E to the diagnosis of COVID-19 pneumonia is discussed.

Virus strain from a mild COVID-19 patient in Hangzhou represents a new trend in SARS-CoV-2 evolution potentially related to Furin cleavage site.

The mutations in the SARS-CoV-2 virus genome during COVID-19 dissemination are unclear. In 788 COVID-19 patients from Zhejiang province, we observed decreased rate of severe/critical cases compared with patients in Wuhan. For mechanisms exploration, we isolated one strain of SARS-CoV-2 (ZJ01) from a mild COVID-19 patient. Thirty-five specific gene mutations were identified. Phylogenetic and relative synonymous codon usage analysis suggested that ZJ01 may be a potential evolutionary branch of SARS-CoV-2. We classified 54 global virus strains based on the base (C or T) at positions 8824 and 28247 while ZJ01 has T at both sites. The prediction of the Furin cleavage site (FCS) and sequence alignment indicated that the FCS may be an important site of coronavirus evolution. ZJ01 mutations identified near the FCS (F1-2) caused changes in the structure and electrostatic distribution of the S surface protein, further affecting the binding capacity of Furin. Single-cell sequencing and ACE2-Furin co-expression results confirmed that the Furin expression was especially higher in glands, liver, kidneys, and colon. The evolutionary pattern of SARS-CoV-2 towards FCS formation may result in its clinical symptom becoming closer to HKU-1 and OC43 caused mild flu-like symptoms, further showing its potential in differentiating into mild COVID-19 subtypes.